Various DNA editing and genome editing techniques

  • restriction nucleases
  • endonucleases, exonucleases
  • zinc finger nucleases (ZFNs)
  • proof-reading mechanisms
  • polymerase
  • terminal deoxytidyl transferase (TdT)
  • recombinase, strand invasion, etc.
  • Cre recombinase
  • Tyr/Ser site-specific recombinase (SSR)
  • zinc-finger recombinase
  • site-specific recombinase
  • CRISPR/Cas9
  • dCas9 (deactivated Cas9, such as without dsDNA double strand breaking activity)
  • Cpf1
  • fCas9
  • dCas13a-GFP (mRNA binding)
  • TALENs (transcription activator-like effector nucleases), TALE proteins, ..
  • TALEN base editors (2020)
  • error-correction enzymes (like MutS)
  • non-homologous end-joining (NHEJ)
  • homologous recombination
  • flippase
  • DNA ligase IV, ligases, ligation, stuff...
  • phage integrase (such as λ phage integrase (Int))
  • phiC31 integrase
  • retroviral integrase
  • recA (a recombinase that doesn't have a specific "core site", but still scans dsDNA for complementarity) (see also Uvsx protein from T4); see "On the mechanism of homology search by recA protein filaments"
  • methyltransferase
  • demethylase (like TET1 or dCas9-Tet1)
  • reverse transcriptases

  • DNA repair pathways, error-prone DNA repair pathways

  • bacterial immune systems
  • chimeric recombinases, various other protein chimeras should be investigated, various fusion protein stuff too..
  • homology-directed repair (HDR) of double-stranded DNA breaks (DSBs)
  • homing endonucleases
  • programmable endonucleases (zinc finger nucleases, TALE nucleases, cas9, fCas9)
  • meganucleases (such as I-CreI meganuclease)
  • targetrons
  • group II introns (mobile ribozymes that invade DNA), such as 3BWP
  • cytidine deaminase, adenosine deaminase
  • RNA-guided adenosine deaminases (ref)
  • histone methyltransferases and also in fusion with Cas9
  • histone deacetylases, histone acetyltransferases like for chromatin modification
  • protein methyltransferases
  • histone acetyltransferase, like in DOI: 0.1021/jacs.8b01518
  • LwaCas13a (previously C2c2), an RNA-guided RNA-targeting CRISPR-Cas effector Cas13a
  • casposons and self-synthesizing DNA transposons (usually including a polymerase and an integrase among others)
  • dCas9-acetyltransferase (dCas9-p300)
  • DNMT1 finds hemimethylated strands and methylates the new strand, possibly combine with strand displacement reactions and phi29 polymerase to make a methylation-preserving amplification chemistry (ref)
  • telomerase
  • Cas9-recombinase fusion proteins
  • DNA polymerase editors: this technology combines Cas9 nickases with DNA polymerases and tethering of a single-stranded DNA template, for example, using an HUH endonuclease. A key difference from prime editing lies in its use of DNA polymerase rather than reverse transcriptase and the delivery of the DNA template in trans
  • CRISPR integrases: based on combining prime editors with site-specific serine recombinases
  • Target-primed reverse transcription: this process involves fusing nickase Cas9 with non-long terminal repeat (non-LTR) retrotransposon-derived reverse transcriptases and RNAs. It operates by nicking the target DNA to generate a free 3′ end to prime reverse transcription of the retrotransposon-associated RNA, resulting in targeted DNA insertion.
  • HEARO (HNH endonuclease-associated RNA and ORF) or OMEGA (obligate mobile element guided activity) nucleases, are encoded within prokaryotic transposable elements in which they contribute to the transposition mechanism and promote transposon retention

transposase stuff:

more stuff:

base editors, prime editors, expanded PAMs like SpRY, mini/split editors, dual editors, high-fidelity/off-target mitigation, organellar editing, RNA editors, epigenome editors, CASTs/casposons, etc..

High-level and clinical reviews

  • Cell Review — “Past, present, and future of CRISPR genome editing technologies.” Wide-angle survey that contrasts nuclease, base, and prime editing; touches delivery, safety, and emerging systems. Great one-stop read. ScienceDirect
  • Frontiers Genome Editing (2024) — “Advances in CRISPR-Cas technology and its applications.” High-level review spanning DNA/RNA editors, delivery, and clinical status. PMC
  • Signal Transduction & Targeted Therapy (2023) — “CRISPR/Cas9 therapeutics: progress and prospects.” Compares editor classes (including BE/PE) with delivery vectors and disease areas. Nature
  • Translational Medicine (2024) — “Cutting-edge applications of base editing and prime editing in disease therapy.” Head-to-head BE vs. PE applications, safety/efficacy, and what’s next clinically. BioMed Central
  • Gene Therapy (2025) — “Prime editing: therapeutic advances and mechanistic insights.” PE generations (PE2/PE3/PE5, epegRNAs, mini/split), performance vs. BE, and translational read-through. Nature
  • “Recent advances in therapeutic gene-editing technologies” (2025). Broad state-of-the-art review of genetic and epigenetic editors with preclinical innovations. ScienceDirect

[Advances in large-scale DNA engineering with the CRISPR system)[https://www.nature.com/articles/s12276-025-01530-0)

Base editors (CBEs/ABEs, enhanced/dual/split/mini, SpRY PAM expansion)

  • Trends in Biotechnology (2023) — “Recent technological advances in base editing.” Covers CBE/ABE families (APOBEC/AID, TadA), BE3/BE4max, ABE7.10/ABE8e/miniABE, windows, fidelity, and engineering knobs. ScienceDirect
  • DNA Repair (2024) — “Advances in base editing: a focus on base transversions.” Good for non-canonical edits, editor architectures, and byproduct control. ScienceDirect
  • Nature Communications Biology (2024) — “Comprehensive evaluation of near-PAMless base editors.” Practical look at SpRY-based CBEs/ABEs (e.g., BE4max-SpRY), prediction of efficiency/outcomes across \~45k sites. Nature
  • Nat Comms (2024) — “PAMless DNA interrogation mechanisms.” Mechanistic perspective on SpRY and relaxed-PAM targeting—useful context for BE4max-SpRY design/limits. Nature
  • MDPI (2025) — “Efforts to downsize base editors for clinical applications.” Summarizes mini-BEs, split designs for delivery, and size/fidelity trade-offs. MDPI
  • Cell Reports Methods/Elsevier (2024) — “Engineering miniature CRISPR-Cas Un1Cas12f1 for cytosine base editing.” Mini-nuclease platform overview (Cas12f1-BEs) relevant to payload-limited delivery. ScienceDirect
  • Nucleic Acids Research (2025) — “Direct delivery of stabilized Cas-embedded CBEs.” Trends in protein (RNP) delivery of BEs—ties to off-target and transient exposure benefits. Academic Oxford
  • mBio (2022) & follow-ons — Dual base editors. Landscape for simultaneous A→G & C→T editors and newer dual strategies. ASM Journals

Prime editors (generations, mini/split, performance)

  • Gene Therapy (2025) — prime editing review. Great on PE2/PE3/PE3-NG, enhanced PE (ePE), pegRNA/epegRNA engineering, and delivery. Nature
  • Cell Reports Methods/Nat Methods ecosystem — split/compact PEs. (Included in broader reviews; practical for miniPE/split-PE delivery constraints.) Nature

RNA editors (protein base editors / dCas13-ADAR; optical control)

  • RNA Biology (2024) — “Programmable RNA targeting with CRISPR-Cas13.” Survey of Cas13/dCas13 tools (knockdown, ADAR fusions for RNA A→I, diagnostics). Taylor & Francis Online
  • Nat Commun (2024) — “Photoactivatable Cas13 RNA base editing.” Optogenetically induced A → I and C → U editing with spatial control. Nature
  • Frontiers Mol Neuroscience (2023) / Mol Ther (2023) — harnessing endogenous ADAR. Reviews programmable A-to-I editing using endogenous/exogenous ADARs, specificity strategies. PMC, Cell

Precision & safety (high-fidelity, off-target, inducible control)

  • Review — “Unintended CRISPR-Cas9 editing outcomes: SVs and how to avoid them.” Pairs well with BE/PE safety discussions. PubMed
  • Opto/chemo control reviews (2024–2025). Roundups of optogenetic CRISPR and chemically inducible gRNA/effector systems; relevant to optogenetically-/chemically-induced base editors, azobenzene-gRNA concepts. ScienceDirect, PubMed, PMC, Academic Oxford

Organellar genome editing (mitochondria and chloroplast)

  • Nature Reviews Methods Primers-style review (2024) — “Base editing of organellar DNA with programmable deaminases.” Excellent on DdCBE/TALED for mtDNA & chloroplast (C→T and A→G). PubMed
  • BMB Reports (2024) — “Mitochondrial genome editing: strategies, challenges, and opportunities.” Nucleases, DdCBE, TALED/TALED-ABE, delivery hurdles. PMC
  • Trends in Plant Science (2025) — chloroplast genome rewriting (perspective). Context on plastid base editing advances (e.g., A→G cpDNA TALEDs). Cell, Nature

Programmable endonucleases & recombinases (ZFNs, TALENs, CASTs/casposons, homing)

  • CASTs/CRISPR-associated transposons review (2024). RNA-guided integration without DSBs; complements BE/PE in payload insertion space. ScienceDirect
  • ZFN engineering review (2024). Useful background on programmable endonucleases alongside TALENs and Cas9. Advanced Online Library

Epigenome editors & writer fusions (dCas9-p300, methyltransferases)

  • Frontiers in Medicine (2025) — “Precision scalpels for the epigenome: next-gen editing.” Broad epigenome-editing overview (activation/repression), including dCas9-p300. Frontiers
  • Critical Reviews in Biochemistry & Mol Biol (2024) — “Epigenome editing for targeted DNA (de)methylation.” Summarizes DNA/histone methyltransferase fusions and best practices. Taylor & Francis Online
  • Biochem Biophys Res Commun (2023) — “Epigenome editing based on CRISPR/dCas9-p300.” Focused review on dCas9-p300 acetyltransferase systems. ScienceDirect

Subject to reference map

  • Core CBEs/ABEs & classic builds (BE3/BE4max, ABE7.10/ABE8e, eA3A-BE3, miniABE): Trends Biotech 2023; DNA Repair 2024; Cell 2024. ScienceDirect
  • Expanded PAM & BE4max-SpRY (near-PAMless): Nat Comms Biology 2024 (near-PAMless BE evaluation); PAMless mechanism paper. Nature
  • Dual/orthogonal/split/mini base editors: mBio dual BE review + mini/split & delivery trends. ASM Journals, MDPI, Academic Oxford
  • Prime editors (PE2/PE3/PE3-NG, ePE, miniPE, split-PE) & BE vs. PE comparisons: Gene Therapy 2025; Translational Medicine 2024; Cell 2024. Nature, BioMed Central, ScienceDirect
  • RNA editors (dCas13-ADAR, protein base editors) + optogenetic control: RNA Biology 2024; Nat Commun 2024 photoactivatable Cas13. Taylor & Francis Online, Nature
  • High-fidelity/off-target mitigation & gRNA-independent effects: SV/off-target review; broad safety discussion in Cell 2024. PubMed, ScienceDirect
  • Delivery (AAV/LNP/RNP) & tissue targeting: Nat Biomed Eng 2025 + delivery overviews. Nature, ScienceDirect
  • Organellar (mitochondria & chloroplast): Methods-style organellar deaminases review + BMB Reports 2024 + plant plastid updates. PubMed, PMC, Nature
  • Epigenome writer fusions (dCas9-p300, methyltransferases): Frontiers Med 2025; CRBMB 2024; BBRC 2023. Frontiers, Taylor & Francis Online, ScienceDirect
  • CASTs/casposons & other mobile systems: CASTs review. ScienceDirect

More

  1. TIGR-Tas: a compact, dual-guide RNA–guided DNA system (brand-new family, not CRISPR). Tiny, modular RNA-guided nucleases that bind/cleave DNA with two spacers; TasR works in human cells. Small size. PubMed, Science

  2. Bridge-RNA–guided recombinases (IS110): programmable, RNA-templated recombination. “Bridge RNAs” specify both target and donor—an RNA-only way to do precise DNA integration/rearrangement (no DSB, no RT). Mechanism papers plus a perspective on building editors from it. Nature

  3. OMEGA/TnpB & IscB mini-nucleases: the post-CRISPR era of ultra-compact RNA-guided editors. 2024–25 engineering shows potent DNA cleavage/base editing with ωRNA guides; RAGATH-18 RNAs activate IS607-TnpB—another small programmable DNase. These are reasonable scaffolds for next-gen base/prime-like writers. PMC, Cell, Nature

  4. CRISPR-associated transposases upgraded: precise, DSB-free kilobase insertions. Type I-F CAST enables large integrations in human cells without breaks; Type V-K “HELIX” solves cointegrates; CRISPR-directed integrases mature. These are a path to routine >1 kb, scar-free gene writing. PMC

  5. PASTE’s successor: PASSIGE outperforms prime-integrase hybrids. A recombinase-first platform with guide-encoded landing sites; very promising for therapeutic-scale insertions. Nature

  6. Prime editing vNext (precision & deliverability). PE7 (La-domain) stabilizes pegRNAs; split-PE architectures run in AAV with strong in-vivo edits; dual inhibition of DNA-PK + Polθ sharply cleans up PEn/PE3/PE5/PE7 outcomes. Nature, PubMed Nature

  7. Deaminase-free & expanded-chemistry base editors (transversions, T/G editing). UNG/TDG-engineered GBEs do T→G/T→C and C→G; protein-LM-optimized UNG variants; deaminase discovery campaigns broaden the enzyme palette. Nature, Cell, PubMed

  8. Miniature editors for delivery (Cas12f/e and friends). 2024–25 shows real jumps in Cas12f1 and Cas12e activity and mini-ABE/CBE performance; “NovaIscB” and related compact effectors are emerging. PubMed, ScienceDirect, MIT McGovern Institute

  9. Light/chemical on-switches for spatiotemporal editing (toward “precision by default”). Photo-activatable Cas13 RNA base editing; blue-light base editors; small-molecule Cas9 switches; azobenzene-modified gRNAs. These could be grafted onto any new scaffold. Nature, PMC, Oxford Academic

  10. Epigenome programming as an editing co-factor. Modular platforms write nine chromatin marks at will; chromatin context changes prime editor (PE) outcomes, pointing to “epigenome-steered gene editing.” Nature, Cell

Fusion-protein (and RNA-scaffold) ideas worth chasing next

  • TasR (TIGR) or IscB + engineered deaminase = ultra-compact base editors. Swap Cas9 for TasR/IscB to get AAV-friendly CBEs/ABEs/GBEs; leverage ωRNA/tigRNA to dock accessory domains (UGI, UNG variants). PubMed, PMC, Cell

  • Bridge-RNA recombinase + serine integrase (Bxb1/TP901) = RNA-programmed site-specific integration with no DSB or RT—bridge RNA picks target & donor; integrase executes clean recombination. Nature

  • CAST/HELIX + reverse transcriptase (“RT-CAST”) = search-and-replace, not just paste. Fuse an RT (prime-like) to HELIX/Type I-F to repair micro-mismatches while integrating payloads—reducing by-products from transposase chemistry. PMC

  • PE7 or split-PE + integrase (“PASTE-lite 2.0”) for efficient landing-site install and high-fidelity payload write-in; combine with DNA-PK/Polθ inhibitors for clinical-grade purity. Nature, PubMed

  • Mini-editor multiplexing: Cas12a/f backbones + deaminase-free GBEs to get parallel, PAM-diverse transversions across many loci from a single transcript. Nature, PubMed

  • Programmable RNA editors beyond Cas13: convert IscB/Cas9 into RNA editors for A→I/C→U with ADAR fusions; add light control for temporally gated transcript fixes. Cell, Nature

  • Chromatin-steered editing: dCas9-SunTag-DNMT3A/p300 modules pre-write local chromatin to boost desired PE/BE outcomes (bias repair, shrink by-products). Oxford Academic, Nature

  • Organellar “writers”: TALE or mito-nickase targeting + new GBEs (e.g., T→G) for mitochondria/plastids—taking 2024 mitoBE rules into true multi-chemistry organellar editing. Nature

Also speculative

  • RNA-guided systems with no PAM and minimal cargo (TIGR-Tas, TnpB/IscB) as universal editing chassis. PubMed, Nature
  • Self-targeting integrase systems (CAST in human cells, HELIX) that handle kilobase payloads without DSBs. PMC
  • Template-free “chemistry editors” via glycosylase/BER engineering to cover all four base conversions cleanly. Nature, PubMed

More reviews

  • Cell (2024) “Past, Present, and Future of CRISPR”. Cell
  • Nat Rev Mol Cell Biol (2024) organellar base editing—mitochondria/plastid focus. PubMed
  • Cells (2025) “Prime Editing: Mechanistic Insights & DNA repair modulation.” MDPI
  • Mol Cell (2023) “Design & application of DNA editing enzymes as base editors.” (and enzyme fusions). PMC

Cytosine Base Editors (CBEs): - dCas9-APOBEC variants (general concept) - BE3 (Base Editor 3) - dCas9-APOBEC1-UGI - BE4max - improved CBE with enhanced efficiency - eA3A-BE3 - enhanced cytosine base editor - BE4max-SpRY - expanded PAM compatibility CBE

AID/APOBEC-dCas9 fusions are fusion proteins combining catalytically dead Cas9 (dCas9) with AID (Activation-Induced Deaminase) or APOBEC (Apolipoprotein B mRNA Editing Catalytic Polypeptide-like) enzymes to perform targeted cytosine-to-uracil editing. AID/APOBEC enzymes naturally deaminate cytosine to uracil in single-stranded DNA, and the dCas9-gRNA complex creates the necessary R-loop structure exposing single-stranded DNA for editing. These are the foundation of cytosine base editors (CBEs). The most common versions use APOBEC variants fused to dCas9, such as BE3, BE4max, and AID/APOBEC1-BE3. These systems successfully convert C-G to T-A base pairs at targeted locations.

Adenine Base Editors (ABEs): - dCas9-TadA variants (ecTadA-dcas9 in original paper) - ABE7.10 - ABE8e - optimized adenine base editor - miniABE - compact adenine base editor

Prime Editors: - PE2, PE3 - successive prime editor improvements - miniPE - compact prime editor - ePE3 variants - enhanced prime editors

dCas9-RT-pegRNA systems: Prime editors could instead be based on dCas9-RT-pegRNA systems, but nickase is significantly more kinetically efficient. This would be deactivated dead Cas9 + reverse transcriptase + prime editing guide RNAs. But, just use nickase instead.

Specialized Systems: - Dual base editors (simultaneous A-to-G and C-to-T) - Programmable base editors with orthogonal gRNAs - Split base editors for improved delivery - Protein base editors (dCas13-ADAR fusions for RNA)


Other

Fanzor is a eukaryotic programmable RNA-guided endonuclease

berkeleygenomics.org primer on methods of germline engineering: statistics of chromosome selection, number of polygenic gene edits/iterations required for a desired IQ increase


Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage

"Here we report the development of base editing, a new approach to genome editing that enables the direct, irreversible conversion of one target DNA base into another in a programmable manner, without requiring dsDNA backbone cleavage or a donor template. We engineered fusions of CRISPR/Cas9 and a cytidine deaminase enzyme that retain the ability to be programmed with a guide RNA, do not induce dsDNA breaks, and mediate the direct conversion of cytidine to uridine, thereby effecting a C→T (or G→A) substitution. The resulting “base editors” convert cytidines within a window of approximately five nucleotides (nt), and can efficiently correct a variety of point mutations relevant to human disease. In four transformed human and murine cell lines, second- and third-generation base editors that fuse uracil glycosylase inhibitor (UGI), and that use a Cas9 nickase targeting the non-edited strand, manipulate the cellular DNA repair response to favor desired base-editing outcomes, resulting in permanent correction of ~15-75% of total cellular DNA with minimal (typically ≤ 1%) indel formation. Base editing expands the scope and efficiency of genome editing of point mutations."


A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells

"We describe the development of 'recCas9', an RNAprogrammed small serine recombinase that functions in mammalian cells. We fused a catalytically inactive dCas9 to the catalytic domain of Gin recombinase using an optimized fusion architecture. The resulting recCas9 system recombines DNA sites containing a minimal recombinase core site flanked by guide RNA-specified sequences. We show that these recombinases can operate on DNA sites in mammalian cells identical to genomic loci naturally found in the human genome in a manner that is dependent on the guide RNA sequences.

"Tyrosine and serine recombinases such as Cre, Flp and C31 integrase have been widely used to catalyze the recombination of exogenous DNA into model organisms (18,19). However, the use of these enzymes has been limited by their intrinsic, non-programmable DNA sequence specificity. Most small serine recombinases, for example, recognize a specific pseudo-palindromic core DNA sequence of approximately 20 base pairs (20). Recombination using these enzymes at endogenous DNA sequences only occurs at 'pseudo-sites' that resemble the recombinase's natural DNA recognition sequence or at genomic sequences for which the recombinase has been experimentally evolved (19,21–26)."

"To increase the number of sites amenable for targeted recombination in cells, researchers have fused hyperactive variants of small serine recombinases to zinc finger and TALE DNA-binding proteins (27–31). Because the catalytic domain and DNA-binding domain are partially modular in some recombinases, replacement of the natural DNA-binding domains with zinc-finger or TALE repeat arrays can partially retarget these enzymes to specified DNA sequences. Although the guide RNA-programmed Cas9 nuclease has quickly grown in popularity due to its relatively unrestricted DNA binding requirements and its ease of use, a guide RNA-programmed recombinase has not been reported."

"Here, we describe the development of recCas9, a guide RNA-programmed small serine recombinase based on the fusion of an engineered Gin recombinase catalytic domain with a catalytically inactive Cas9. The recCas9 enzyme operates on a minimal pseudo-core recombinase site (NNNNAAASSWWSSTTTNNNN) flanked by two guide RNA-specified DNA sequences. Recombination mediated by recCas9 is dependent on both guide RNAs, resulting in orthogonality among different guide RNA:recCas9 complexes, and functions efficiently in cultured human cells on DNA sequences matching those found in the human genome. The recCas9 enzyme can also operate directly on the genome of cultured human cells, catalyzing a deletion between two recCas9 psuedosites located approximately 14 kb apart. This work represents a key step toward engineered enzymes that directly and cleanly catalyze gene insertion, deletion, inversion or chromosomal translocation with user-defined, single base-pair resolution in unmodified genomes."

"Our group and others recently demonstrated that the N-terminus of dCas9 could be fused to the FokI nuclease catalytic domain, resulting in a dimeric dCas9-FokI fusion that cleaved DNA sites flanked by two guide RNA-specified sequences (10,11). We used the same fusion orientation to connect dCas9 to Gin, a highly active catalytic domain of dimeric Gin invertase previously evolved by Barbas et al. (34). Gin promiscuously recombines several 20-bp core ‘gix’ sequences (34) related to the native core sequence CTGTAAACCGAGGTTTTGGA (41–43). We envisioned that the guide RNAs would localize a recCas9 dimer to a gix site flanked by two guide-RNA specified sequences, enabling the Gin domain to catalyze DNA recombination in a guide RNA-programmed manner (Figure 1D)."

"We varied parameters influencing the architecture of the recCas9 components, including the spacing between the core gix site and the guide RNA-binding site (from 0 to 7 bp), as well as linker length between the dCas9 and Gin moieties ((GGS)2, (GGS)5 or (GGS)8) (Figure 2A-F). Most fusion architectures resulted in no observable guide RNA-dependent EGFP expression (Figure 1C and D). However, one fusion construct containing a linker of eight GGS repeats and 3- to 6-base pair spacers resulted in approximately 1% recombination when a matched, but not mismatched, guide RNA was present (Figure 2E and F). Recombination activity was consistently higher when 5-6 base pairs separated the dCas9 binding sites from the core (Figure 2F). These results collectively reveal that specific fusion architectures between dCas9 and Gin can result in guide RNA-dependent recombination activity at spacer-flanked gix pseudo core sites in human cells. We refer to this 8xGGS linker fusion construct as ‘recCas9’."

"The findings reported here provide a foundation toward RMCE (recombinase-mediated casette exchange) on native genomic loci that would require two complete recCas9 target sites to be proximal to each other. The estimated 450 human genomic sites identified in silico for recCas9 might be expanded substantially by replacing the Gin recombinase catalytic domain with other natural or manmade small serine recombinases that recognize different core sequences; many of these related enzymes have also been directed to novel sites via fusion to zinc finger proteins (19,63). Moreover, recent work altering Cas9 PAM binding specificity and the recent discovery of numerous Cas9 orthologs raise the possibility of further expanding the number of potential recCas9 sites (64–67). Extending the approach developed here may eventually lead to tools capable of specific, seamless integration of exogenous DNA into the human genome. [...] . While we carried out extensive optimization of the chimeric recCas9 to improve its activity (Figure 2), we imagine that further improvements, e.g. by evolving the chimeric fusion or using a recombinase domain with a broader sequence tolerance, may increase the activity and substrate scope of recCas9-mediated genomic modification. [......] the existence of recombination 'hot spots' or 'cold spots' biases the chromosomal regions that participate in crossover events and thus, the amount of diversity that can be combined into progeny using unassisted breeding (69). [...] the capabilities of recCas9 may further contribute to breeding efforts using elite cultivars by allowing researchers to manipulate the location of crossover events during meiosis. RecCas9 or future variants, in principle, could enhance or decrease the rate of recombination at specified loci, without introducing foreign DNA into the plant genome, by catalyzing favorable translocation events or removing specific mutational 'hot spots' that result in unfavorable crossover events."


Redesigning recombinase specificity for safe harbor sites in the human genome

"... we set out to identify mutations that enable unrestricted recombination between minimal recombination sites."

"However, because of their strict recognition capabilities, recombinase-mediated genome engineering has been limited to cells that contain either pre-introduced target sites or rare pseudo-recombination sites [21]. To overcome this, numerous protein engineering strategies have been developed to alter recombinase specificity [22]. Yet despite several successes [23, 24], these approaches have routinely led to enzymes with relaxed recognition specificities [25, 26], stemming from the fact that many recombinases display an intricate and overlapping network of catalytic and DNA-binding interactions. In contrast to the SSRs described above, the resolvase/invertase family of serine recombinases [27] are modular in both structure and function, allowing the DNA-binding domains of these enzymes to be replaced without impairing catalytic function [28, 29] (Fig 1)."


"Continuous evolution of site-specific recombinases with highly reprogrammed DNA specificities"

"Nonreplicative homologous RNA recombination: Promiscuous joining of RNA pieces?"

"Mechanism of homologous recombination from the RecA–ssDNA/dsDNA structures"


"IVA cloning: A single-tube universal cloning system exploiting bacterial in vivo assembly" http://www.nature.com/articles/srep27459 ("in vivo assembly" cloning, using recA for homologous recombination)

"The presence of a recA-independent homologous recombination pathway in E. coli was reported more than 20 years ago[19,20,21], but has been neglected until recently, except for sporadic use in specific high throughput applications[22,23]. The pathway is mostly uncharacterised but is most efficient at recombining linear DNA fragments, likely acting through an annealing mechanism[20,24], although alternative mechanisms have been suggested[25,26]. Conveniently, the recA-independent pathway is responsible for the recombination of short overlapping sequences[19], whereas the recA system requires longer homologous DNA stretches (>150-300 bp)."

"IVA cloning exploits a recA-independent recombination pathway, which is emerging as a powerful tool in DNA manipulation. Initial reports of this bacterial pathway and its application to cloning were not rapidly adopted, possibly due to the simultaneous reporting of in vivo cloning using bacterial strains expressing phage recombinases[51], which are now widely used for genome engineering[52]. While the recA-independent pathway has recently been utilised as a cloning tool in AQUA cloning, the protocols involved for its use in vivo require multiple PCRs, gel extraction, mixing of DNA fragments and incubation prior to transformation[28,29,30]. [....] Performing separate PCR reactions may increase efficiency when assembling >5 DNA fragments, since longer homologous regions can be included that could cause primer annealing problems if mixed in a single tube [...] While IVA is advantageous for almost all cloning applications, multiple modification of very large plasmids, such as BACs, which cannot be PCR amplified, would require different a different approach."

Uvsx (from phage) does not have long homology requirement like recA, shorter homology works

man, why haven't we made a primerless PCR with promiscuous polymerase yet


"Drag-and-drop genome insertion of large sequences without double-strand DNA cleavage using CRISPR-directed integrases" https://www.nature.com/articles/s41587-022-01527-4

prime editing was the RT fusion; here it's a dCas9 + RT + integrase fusion.

from the twitter peanut gallery: "“CRISPR-directed integrases” is a misleading term. It’s more appropriate to use “Prime Editing directed integrases”."

Protein parts

  • DNA recognition domain
  • DNA binding domain
  • polymerase catalytic domain
  • whatever the active sites are, for each of the above proteins and systems
  • recombinase catalytic domain

Homologous recombination for DNA assembly

https://groups.google.com/d/msg/enzymaticsynthesis/uyZqtJO24RE/lApLb4JmCAAJ

http://gnusha.org/logs/2016-11-18.log

http://gnusha.org/logs/2016-11-19.log

Also, programmatic DNA synthesis could be achieved with programmable recombination. Use a bead with attached DNA. Use recCas9 (guide RNA programmable recombinase) to extend each of the DNA molecules. Wash or flush any non-recombined reactants and byproducts. Insert guide RNA and recCas9 for next cycle, plus next DNA fragment.


zinc-finger recombinases

"Targeted plasmid integration into the human genome by an engineered zinc-finger recombinase" https://academic.oup.com/nar/article/39/17/7868/2411376/Targeted-plasmid-integration-into-the-human-genome

book chapter about zinc-finger recombinases http://www.scripps.edu/barbas/pdf/GajMethEnzymology2014.pdf

Fusion proteins for programmable methyltransferase

nanopore + polymerase

"Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array" http://www.pnas.org/content/113/19/5233.short

"Design and characterization of a nanopore-coupled polymerase for single-molecule DNA sequencing by synthesis on an electrode array" http://www.pnas.org/content/113/44/E6749.short

fusion protein of nanopore + polymerase?

ligand-linked peptide inhibitor, with azobenzene, to inhibit an active domain inside of a nanopore?

Terminology in genetic engineering

hypomorph: a mutant allele that produces a partially reduced level of gene activity or protein function relative to the normal wild‑type allele.

hyperomorph: a mutant allele that confers an enhanced or constitutively active level of gene expression or protein function compared with the normal wild‑type allele.

gain-of-function: a mutation that endows a gene or its protein product with increased, novel, or constitutive activity relative to the normal wild‑type allele.

loss-of-function: a mutant allele that diminishes or eliminates gene activity or protein function compared with the normal wild‑type allele.

deleterious SNP: a single‑nucleotide polymorphism that reduces or disrupts normal gene or protein function, resulting in a harmful phenotypic effect.

knockout: a genetic strategy that completely abolishes the activity of a specific gene, typically by deleting or disrupting its coding sequence.

conditional knockout: a genetically engineered approach that inactivates a target gene only in defined tissues or at particular developmental stages, usually via inducible site‑specific recombination.

knock‑in: a precise genetic engineering strategy that inserts a defined sequence (e.g., a point mutation, epitope tag, or reporter) into the endogenous locus without disrupting overall gene structure.

conditional knock‑in: a knock‑in allele that can be activated or altered only in selected tissues or at chosen developmental times, typically by Cre‑mediated recombination of a “floxed” stop cassette or mutation.

knockdown: a technique that diminishes the expression level of a gene, often through RNA interference or antisense methods, without entirely eliminating its function.

over‑expression: introduction of an exogenous DNA construct (often under a strong, heterologous promoter) that drives ectopic or supraphysiological levels of the gene product throughout the organism or in a defined tissue.

inducible expression (Tet‑On/Tet‑Off): a transgenic system in which gene expression is turned on (Tet‑On) or off (Tet‑Off) by administration or withdrawal of doxycycline, allowing temporal control of a gain‑of‑function allele.

neomorphic: a mutant allele that gives the gene product a new activity or property that is not exhibited by the wild‑type protein (e.g., a novel binding specificity).

antimorph: a mutant allele that antagonizes the wild‑type allele’s function, usually by forming non‑functional complexes; it is often synonymous with a dominant‑negative effect.

dominant‑negative: a mutant allele that encodes a protein capable of interfering with the activity of the wild‑type protein (or its partners), thereby suppressing normal function even in the presence of a functional copy.

null allele: a mutation that eliminates all detectable activity of the gene product (e.g., a premature stop codon or large deletion) and is functionally equivalent to a complete loss‑of‑function but may retain transcription of a non‑coding transcript.

humanized allele: an allele in which the coding sequence (or regulatory region) is replaced with the orthologous human sequence, allowing functional studies of human‑specific variants in an in‑vivo context.

Cre‑dependent (lox‑STOP‑lox) allele: a cassette inserted upstream of a gene of interest that blocks transcription until Cre recombinase excises the flanked STOP sequence, enabling spatially restricted activation of the downstream gene.

CRISPR activation (CRISPRa) / repression (CRISPRi) allele: a dCas9‑based system in which a catalytically dead Cas9 fused to transcriptional activators or repressors is guided to a promoter region to up‑ or down‑regulate endogenous gene expression without altering the DNA sequence.

zinc‑finger activation allele: a programmable zinc‑finger protein engineered with a transcriptional activation domain (e.g., VP64, VPR) that binds a native promoter region to up‑regulate endogenous gene expression without altering the DNA sequence. See also CRISPRa.

CRISPR‑CORRECT: a genome‑editing method to create predictable zygosity. (ref)

splice-modulating base-editing allele (CRISPR-SKIP / SPLICER): a precise genome-editing strategy in which base editors (without creating double-strand breaks) are targeted to splice donor or acceptor motifs to force predictable exon skipping or inclusion at the endogenous locus, effectively creating hypomorph, null, or isoform-specific alleles by rewiring splicing rather than disrupting the entire coding region (e.g., CRISPR-SKIP in Gapinske et al., 2018; SPLICER platform for optimized splice-site editing, 2024).

cis-regulatory motif-edited allele (prime editing of TF binding sites): an allele generated by base or prime editing of a specific transcription factor recognition motif (such as a CArG box) within an endogenous promoter or enhancer, allowing tissue-specific up- or down-regulation of gene expression by changing only one or a few bases in non-coding DNA while leaving the coding sequence intact (e.g., Gao et al., 2021 editing a single CArG motif in the Tspan2 promoter to abolish smooth-muscle expression).

enhancer-targeted CRISPRi/CRISPRa allele: a configuration in which a catalytically dead Cas9 fused to repressor (KRAB, KRAB–MeCP2) or activator (VP64, p300, VPR) domains is stably expressed, and guide RNAs are designed to bind distal enhancers—rather than the core promoter—so that the element’s activity and its long-range control of one or more genes can be selectively repressed or boosted in a cell-type-specific or inducible manner (e.g., Fulco et al., 2016 tiling non-coding regions; Li et al., 2020 enCRISPRi/enCRISPRa in vivo).

dCas9-KRAB-MeCP2 epigenetic repression allele: a specialized CRISPRi configuration in which dCas9 is fused to both KRAB and MeCP2 to recruit heterochromatin and DNA-methylation machinery, producing stronger and more durable silencing of endogenous promoters or enhancers than KRAB alone, effectively modeling a stable loss-of-function or hypomorphic regulatory state without altering the underlying DNA sequence (e.g., Duke et al., 2020).

synthetic intron-enhanced allele: an engineered allele in which one or more well-designed introns are inserted into a transgene or endogenous locus to increase transcription, improve mRNA processing, and/or reduce epigenetic silencing, leveraging intron-mediated enhancement to achieve higher and more stable expression while preserving the native protein sequence (e.g., engineered introns in Cas9 expression cassettes as in Arana et al., 2025, and broader intron-mediated enhancement work summarized by Rose and colleagues).

refactored regulatory locus / synthetic locus allele: a heavily redesigned version of an endogenous genomic region in which large stretches of native non-coding DNA (transposons, repetitive elements, non-essential introns, and idiosyncratic regulatory clutter) are deleted, compacted, or replaced with standardized, well-characterized regulatory parts, yielding a “clean” locus that maintains near-wild-type gene expression and organismal fitness while being easier to analyze and re-engineer (e.g., Sc2.0 synthetic yeast chromosomes where retrotransposons and many introns were removed or rewritten with minimal impact on growth and global transcription).

CRISPR saturation mutagenesis library (non-coding tile library): a densely spaced library of CRISPR guides (using nuclease, CRISPRi, or CRISPRa) that target essentially every position across a promoter, enhancer, or larger non-coding region, generating a spectrum of regulatory alleles whose functional impact on gene expression or fitness is read out in bulk or single-cell assays, thereby mapping which bases and sub-elements are necessary, sufficient, or redundant for regulatory activity (e.g., non-coding tiling screens around oncogenes and ENCODE-scale maps like those summarized by Yao et al., 2024).

MPRA-validated regulatory variant library: a collection of synthetic promoter or enhancer variants cloned into barcoded reporter constructs and assayed in parallel (massively parallel reporter assays, MPRAs), producing a quantitative landscape of sequence→activity relationships that can be linked back to specific endogenous elements, enabling the design of neomorphic, hypomorphic, or hypermorphic regulatory alleles with partially predictable expression outputs (e.g., large MPRA studies and reviews such as Moeckel et al., 2024 that benchmark enhancer and promoter sequence–function maps).

PASTE-integrated knock-in allele: a large-cargo knock-in allele created by PASTE (Programmable Addition via Site-specific Targeting Elements), in which a Cas9 nickase–reverse transcriptase–integrase fusion installs a targeting element and a serine integrase then docks DNA fragments up to tens of kilobases at the edited locus without relying on HDR. (ref)

CRISPR-associated transposase (CAST) insertion allele: an allele generated by RNA-guided transposase systems (for example Cas12k–Tn7 complexes) that integrate multi-kilobase donor cassettes at defined genomic sites in a DSB-free, HDR-independent manner, expanding targeted knock-in to difficult-to-edit cells and in vivo contexts. (ref)

CRISPRoff/CRISPRon epigenetic memory allele: an allele whose expression state is durably silenced or activated by dCas9 fusions that write or erase DNA methylation and repressive histone marks at promoters or enhancers, producing long-lived, mitotically heritable regulatory loss- or gain-of-function without changing the underlying DNA sequence. (ref)

optogenetic control allele: an engineered allele in which the protein of interest or a synthetic transcription factor is fused to light-responsive domains (such as CRY2/CIB1, LOV2, or iLID), so that illumination with specific wavelengths produces precise, reversible activation, clustering, or relocalization of the gene product in vivo. (ref)

CRISPR-based gene drive allele: a cassette that encodes both Cas9 (or another nuclease) and its guide RNA within a locus such that, during meiosis, the drive copies itself onto the homologous chromosome via HDR, biasing inheritance and enabling population-level spread of loss- or gain-of-function traits (e.g., vector control in mosquitoes). (ref)

CRISPR lineage-recorder / evolving barcode allele: a synthetic genomic cassette containing arrays of CRISPR target sites that are progressively edited during development or over time, accumulating unique mutation patterns that serve as heritable barcodes for high-resolution lineage tracing and fate-mapping when read out by sequencing. See lineage tracing.

Cas13-mediated RNA knockdown allele: a configuration expressing an RNA-targeting Cas13 effector and guide RNAs so that specific transcripts, including alternatively spliced isoforms, are degraded without altering the genomic DNA, providing a programmable, often more specific alternative to RNAi-based knockdown. (ref)

Cas13-based RNA base-editing allele (REPAIR/RESCUE and derivatives): an allele configured to express catalytically dead Cas13 fused to ADAR-family deaminases, together with appropriate guide RNAs, to install programmable A→I or C→U edits in target RNAs, enabling transient rescue or mimicry of coding mutations at the transcript level without permanent genomic change. (ref)

TODO: splicing variants, introns, exons, regulatory casette stuff using recombinases and Cre/Flp, enhancers, cell-specific enhancers, floxed alleles, synthetic introns, synthetic exons, Sc2.0 synthetic yeast genome project, synthetic human genome project (HGP-write and also Sc2.0's human consortium from tom ellis), inducibe degradation tags, ...

TODO

feedback TODO

incorporate the following feedback into this page:

"There are superior alternative PAM variants. PAMless editors have unacceptable genome-wide off-targets from a human clinical perspective. MQKFRAER and VRQR are able to target NGC and NGA PAMs respectively with offtarget reductions that are acceptable at a human clinical level by the FDA. One of the best labs for this has been the Kleinstiver lab who I don’t see a mention of, and their variants are really the internal standard in major gene editing companies. I guess there’s xCas9 from the Liu lab for PAMless which the page is missing, but that one really doesn’t work well."

"Base editors often have spurious deamination in a guide-independent manner. C to T editors tend to have this as a problem when utilizing an APOBEC deaminase. Dieter Lam et al. evolved their ABE editor into a CBE editor which only performs work when bound with cas9, and has much slower kinematics which reduces off-targets genome-wide to undetectable levels when dosage is calibrated well."

"I would say Bridge editing from the Hsu lab is extremely promising, but you have that listed already."

"RNA editing and cpf1 are largely a disappointing field- the discoverer of cpf1, Bernd Zetsche abandoned cpf1 entirely due to its abysmal baseline activity. One RNA editing team found that the effects are so transient that there isn’t any sort of lasting effect without a more serious transgene insertion (which would be obviated by direct nuclease or insertion editing of the actual problem anyway)."

"For epigenetic editors, you’re missing a couple variant editors. KRAB alone typically isn’t durable repression at most sites- methylation is required quite often in most actively dividing cells, and even then it’s not guaranteed. I was pretty surprised the list didn’t have a dedicated mention for CRISPRoff by name, which uses the DNMT3A/3L or DNMT1 methyltransferases that lock in durability of repression. There is also that one very large HTS paper that found ZNF10 and other truncated miniaturized effector domains which is the current state of the art. I also didn’t see any reference to CRISPRa or the VPR tripartite activator. MeCP2, HDAC, LSD1, are also such variants for example that I didn’t see mentioned after an initial parsing, but you did include p300 and TET1. There’s a whole class of editors with various epigenetic effector fusions, as the pathway is quite complex. I think there should be literature included to explain the differences between distal enhancers vs proximal promoters, up vs downstream of gene editing. There was also no mention of CTCF sites which I know Moonwalk is working on."

"There’s also TREX2 which inhibits nuclease editing, as well as prime editing. But flattening editing rates is actually useful if trying to only get on-target editing while reducing off-target. Peak flattening can lower off-targets to undetectable with still enough potency to achieve a precise on-target edit. Cas9-TREX2 fusions have been used to this end."

"currently for bulk ex vivo, pam specific variants are qc’d to show negligible off targets in millions of cells then just put into people like that rather than selecting away bad mutants."

logs

http://gnusha.org/logs/2017-09-22.log

http://gnusha.org/logs/2017-09-27.log

http://gnusha.org/logs/2017-09-28.log

http://gnusha.org/logs/2017-09-29.log

See also