From: dudescholar (dudescholar@rationaltheology.com)
Date: Tue Mar 19 2002 - 22:41:08 MST
Soon someone will write a book "Secret Codes in Human DNA written in
English millions of years ago!" <grin>
-- Steve - dudescholar@yahoo.com, dudescholar@rationaltheology.com "During times of universal deceit, telling the truth becomes a revolutionary act." - George Orwell > -----Original Message----- > From: owner-extropians@extropy.org [mailto:owner-extropians@extropy.org] On Behalf > Of Mike Lorrey > Sent: Tuesday, March 19, 2002 2:46 PM > To: extropians@extropy.com > Subject: DNA encryption tool > > CAGTCTTTGGTATCGTTGTACTAGTGGTTGTCTGTATAAGGATTGTCTTAGTTGT > CGGGATACGCTTTGTCTGGTGGATTGGCTGGATGCGTAGCGGGATTTAACATGT > TTAGCATCTTTAGCAGGATGTGTTCTTCCTAGTATGTAGCATACTCGTTGTCCTG > AGTTGGATTTAACAAA > > In the above code is a message. This could be encoded into synthesized > DNA that you could conceal in the ink of a letter, the water used to wet > a stamp, or a plethora of other concealment methods. To decode, check > out this website: > > http://www.attotron.com/cybertory/analysis/secret.htm > > Is this supercool or what? >
This archive was generated by hypermail 2.1.5 : Sat Nov 02 2002 - 09:13:02 MST