Research Article
Synthesis of deoxyoligonucleotides on a polymer support
Note: In lieu of an abstract, this is the article's first page.
Citing Articles
Citation data is made available by participants in CrossRef's Cited-by Linking service. For a more comprehensive list of citations to this article, users are encouraged to perform a search in SciFinder.
This article has been cited by 43 ACS Journal articles (5 most recent appear below).

Solution-Phase Synthesis of Branched DNA Hybrids Based on Dimer Phosphoramidites and Phenolic or Nucleosidic Cores
Helmut Griesser, Mariyan Tolev, Arunoday Singh, Thomas Sabirov, Claudia Gerlach, and Clemens RichertThe Journal of Organic Chemistry2012 77 (6), 2703-2717Solution-Phase Synthesis of Branched DNA Hybrids Based on Dimer Phosphoramidites and Phenolic or Nucleosidic Cores
Helmut Griesser, Mariyan Tolev, Arunoday Singh, Thomas Sabirov, Claudia Gerlach, and Clemens RichertThe Journal of Organic Chemistry2012 77 (6), 2703-2717Branched oligonucleotides with “CG zippers” as DNA arms assemble into materials from micromolar solutions. Their synthesis has been complicated by low yields in solid-phase syntheses. Here we present a solution-phase synthesis based on phosphoramidites of ...

Streamlined Process for the Chemical Synthesis of RNA Using 2′-O-Thionocarbamate-Protected Nucleoside Phosphoramidites in the Solid Phase
Douglas J. Dellinger, Zoltán Timár, Joel Myerson, Agnieszka B. Sierzchala, John Turner, Fernando Ferreira, Zoltán Kupihár, Geraldine Dellinger, Kenneth W. Hill, James A. Powell, Jeffrey R. Sampson, and Marvin H. CaruthersJournal of the American Chemical Society2011 133 (30), 11540-11556Streamlined Process for the Chemical Synthesis of RNA Using 2′-O-Thionocarbamate-Protected Nucleoside Phosphoramidites in the Solid Phase
Douglas J. Dellinger, Zoltán Timár, Joel Myerson, Agnieszka B. Sierzchala, John Turner, Fernando Ferreira, Zoltán Kupihár, Geraldine Dellinger, Kenneth W. Hill, James A. Powell, Jeffrey R. Sampson, and Marvin H. CaruthersJournal of the American Chemical Society2011 133 (30), 11540-11556An improved method for the chemical synthesis of RNA was developed utilizing a streamlined method for the preparation of phosphoramidite monomers and a single-step deprotection of the resulting oligoribonucleotide product using 1,2-diamines under ...

Targeting G-Quadruplex Structure in the Human c-Kit Promoter with Short PNA Sequences
Jussara Amato, Bruno Pagano, Nicola Borbone, Giorgia Oliviero, Valérie Gabelica, Edwin De Pauw, Stefano D’Errico, Vincenzo Piccialli, Michela Varra, Concetta Giancola, Gennaro Piccialli, and Luciano MayolBioconjugate Chemistry2011 22 (4), 654-663Targeting G-Quadruplex Structure in the Human c-Kit Promoter with Short PNA Sequences
Jussara Amato, Bruno Pagano, Nicola Borbone, Giorgia Oliviero, Valérie Gabelica, Edwin De Pauw, Stefano D’Errico, Vincenzo Piccialli, Michela Varra, Concetta Giancola, Gennaro Piccialli, and Luciano MayolBioconjugate Chemistry2011 22 (4), 654-663The cKit87up sequence d(5′AGGGAGGGCGCTGGGAGGAGGG3′) can form a unique G-quadruplex structure in the promoter region of the human c-kit protooncogene. It provides a peculiar platform for the design of selective quadruplex-binding agents, which could ...

Comparisons between Chemical Mapping and Binding to Isoenergetic Oligonucleotide Microarrays Reveal Unexpected Patterns of Binding to the Bacillus subtilis RNase P RNA Specificity Domain
Ruiting Liang, Elzbieta Kierzek, Ryszard Kierzek, and Douglas H. TurnerBiochemistry2010 49 (37), 8155-8168Comparisons between Chemical Mapping and Binding to Isoenergetic Oligonucleotide Microarrays Reveal Unexpected Patterns of Binding to the Bacillus subtilis RNase P RNA Specificity Domain
Ruiting Liang, Elzbieta Kierzek, Ryszard Kierzek, and Douglas H. TurnerBiochemistry2010 49 (37), 8155-8168Microarrays with isoenergetic pentamer and hexamer 2′-O-methyl oligonucleotide probes with LNA (locked nucleic acid) and 2,6-diaminopurine substitutions were used to probe the binding sites on the RNase P RNA specificity domain of Bacillus subtilis. ...

Highly Stereoselective Synthesis of α-d-Mannopyranosyl Phosphosugars
David Crich and Sébastien PicardThe Journal of Organic Chemistry2009 74 (24), 9576-9579Highly Stereoselective Synthesis of α-d-Mannopyranosyl Phosphosugars
David Crich and Sébastien PicardThe Journal of Organic Chemistry2009 74 (24), 9576-9579α-Mannopyranosyl phosphosugars are obtained in 61−90% yields from 4,6-O-benzylidene-protected mannosyl thioglycosides bearing ester functionality in the 3-O-position by coupling reactions with ammonium salts of phosphosugars on activation with 1-...
Tools
-
Add to Favorites
-
Download Citation
-
Email a Colleague -
Permalink
Order Reprints
Rights & Permissions
Citation Alerts
History
- Published In Issue June, 1981
Cart

ACS
Network







