DNA encryption tool

From: Mike Lorrey (mlorrey@datamann.com)
Date: Tue Mar 19 2002 - 15:46:28 MST


CAGTCTTTGGTATCGTTGTACTAGTGGTTGTCTGTATAAGGATTGTCTTAGTTGTCGGGATACGCTTTGTCTGGTGGATTGGCTGGATGCGTAGCGGGATTTAACATGTTTAGCATCTTTAGCAGGATGTGTTCTTCCTAGTATGTAGCATACTCGTTGTCCTGAGTTGGATTTAACAAA

In the above code is a message. This could be encoded into synthesized
DNA that you could conceal in the ink of a letter, the water used to wet
a stamp, or a plethora of other concealment methods. To decode, check
out this website:

http://www.attotron.com/cybertory/analysis/secret.htm

Is this supercool or what?



This archive was generated by hypermail 2.1.5 : Sat Nov 02 2002 - 09:13:02 MST